Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_005019 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | T2DM with depression | ICD-10 | Type 2 diabetes mellitus (E11) |
DBLink | Link to database | PMID | 28779132 |
Experimental Method | |||
Sample Type | Blood samples | Comparison | Seven patients with Type 2 Diabetics Mellitus T2DM (four women and three men, age range: 48-65 years, average age: 58.14 years) with current major depressive episodes (the DM1 group) and seven patients with T2DM (four women and three men, age range: 41-69 years, average age: 58.28 years) without major depressive episodes |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GCAGTGTGTCTGGTCTTATGAGAAC ReverseTCAGAACCCTCACTTGAGAAGAACT | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Jiang, G, Ma, Y, An, T, Pan, Y, Mo, F, Zhao, D, Liu, Y, Miao, JN, Gu, YJ, Wang, Y, Gao, SH (2017). Relationships of circular RNA with diabetes and depression. Sci Rep, 7, 1:7285. |